albA [2019-03-12 18:55:13]

radical S-adenosylmethionine enzyme, antilisterial bacteriocin (subtilosin) production

Locus: BSU37370

Isoelectric point: 6.20

Molecular weight: 51.35 kDa

Protein length: 448 aa

Gene length: 1347 bp

Function: antilisterial bacteriocin (subtilosin) production

Product: radical S-adenosylmethionine enzyme

Essential: no

Synonyms: ywiA

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Additional metabolic pathways → Miscellaneous metabolic pathways → Biosynthesis of antibacterial compounds
• Lifestyles → Coping with stress → Biosynthesis of antibacterial compounds

Gene

Coordinates: 3,836,323 → 3,837,669

The protein

Catalyzed reaction/ biological activity

• catalyzes thioether bond formation in subtilosin A PubMed

Cofactors

• contains two Fe-S clusters PubMed

Expression and Regulation

Operons

• Genes: sboA-sboX-albA-albB-albC-albD-albE-albF-albG
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • Rok: repression, PubMed, in Rok regulon
  • ResD: activation, PubMed, in ResD regulon
  • AbrB: repression, PubMed, in AbrB regulon

  Regulation

  • expressed under anaerobic conditions (ResD) PubMed
  • expression of the operon is strongly induced at the beginning of biofilm formation PubMed

Biological materials

Mutant

• MGNA-B263 (ywiA::erm), available at the NBRP B. subtilis, Japan
• BKE37370 (ΔalbA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAAAATACCATCCCCTATAC, downstream forward: _UP4_CAGCTTATTTAGGAGGGAAA
• BKK37370 (ΔalbA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAAAATACCATCCCCTATAC, downstream forward: _UP4_CAGCTTATTTAGGAGGGAAA

References

Loading